Key signal
The library key signal is determined in the first eight flows of the sequencing run. The library key sequence is TCAG and all four nucleotides (T, C, A, and G) are incorporated during the first eight nucleotide flows.
Note: The library and test fragment (TF) keys, and the flow order can be found under the Analysis Details section of the run report.
|
Analysis detail |
Example |
Description |
|---|---|---|
|
Flow Order |
TACGTACGTCTGAGGATCGATGTACAGC |
The order in which the chip is exposed to each particular dNTP. |
|
Library Key |
TCAG |
A short known sequence of bases used to distinguish the library fragment from the test fragment. |
|
TF Key |
ATCG |
The nucleotide sequence that is used to identify test fragment reads. |
The reported key signal is the average signal (post software processing) for all ISPs that identically match the library key (TCAG). Each templated library ISP in a well has many library templates (ideally, clonally amplified during template preparation) all of which contribute to the dNTP incorporation signals reported for that well. The more templates per ISP, the higher the reported incorporation signal is for that well. In simple terms, the key signal essentially measures the number of templates per ISP or the efficiency of the template preparation reaction.
When the library key signal is lower than expected, increased 3’ quality trimming can result, especially for long reads (400-base read sequencing). Over the sequencing run, as with all sequencing by synthesis technologies, the signal that is generated drops due to the reaction conditions (polymerase dissociation) and eventually becomes indistinguishable from the background noise. As the signal generated approaches the background noise, the quality of the read decreases and is subject to 3’ quality trimming by the software. Therefore, the higher the starting key signal, the less the impact of the signal droop and the less 3’ quality trimming is expected to occur.